Clostridium difficile toxin B cells the expression of functional areas.docVIP

 PAGE \* MERGEFORMAT 7 Clostridium difficile toxin B cells the expression of functional areas Author: Liu Sheng, Qing-Hua Zhang, Jiang Bo, Jiang Zhi-xin [Keywords:] Clostridium difficile, the cell toxin B; Cloning, Molecular; gene expression [Keywords:] Clostridium difficile, the cell toxin B; Cloning, Molecular; gene expression 1 Materials and methods 1.1 Material restriction endonuclease, T4DNAligase purchased from New England Biolab Corporation. Anaerobic occurred agent, brain heart infusion (powder) were purchased from bioMé rieux (bioMerieux). Other reagents of analytical grade. Clostridium difficile ( clostridium difficile, Cd VPI10463) from Lanzhou Institute of Biological Products to buy. E. coli strain BL21 (DE3) and plasmid PET22b () digestion, Southern Medical University Institute of deposit. 1.2 Methods 1.2.1 the target gene to obtain Cd VPI 10463 was inoculated into brain heart infusion (BHI) medium, 37 ℃ anaerobic environment of 72 h. dialysis cultures Cd alkaline lysis method of extracting genomic DNA. Reference Gene bank intake of Cd VPI 10463 gene sequences, design primers, such as: sense: 5’TCCGAATTCG CTTATGTCAACTAGTGAA3 ‘EcoRI, antisense: 5’GCACTCGAGTTCACTAATCACTAATTG3’, XhoI. reaction conditions: 50 μ L reaction system, hot-start method, 94 ℃ denaturation 45 s, 60 ℃ annealing 60 s, 72 ℃ for 150 s, 39 cycles and then an extension of 10 min. 10 g / L glucose gel electrophoresis results of amplification. 1.2.2 Construction and identification of recombinant plasmid will be digested, purified target gene, plasmid PET22b () by 10:1 (mole number) at 16 ℃ under T4DNAligase connect 12 h. Heat shock was transformed. Pick a single colony, the vaccination in selective LB liquid medium, A600 nm value of 0.6, extract the recombinant plasmid. recombinant plasmid: The EcoRI and XhoI double restriction enzyme digestion; with recombinant plasmid as a template for PCR reaction, the company sent to Shanghai PBL sequencing. 1.2.3 Cloning of target