Next Generation Sequencing(NGS) 高通量测序.pptxVIP

Next Generation Sequencing (NGS, 2nd~ Generation sequencing) Sanger Sequencing (1st generation sequencing) 1 4 3 2 Gel electrophoresis 5 Chain termination or dideoxy method (F. Sanger) 5 Steps: Denaturation → Primer attachment → extension of bases → Termination → Gel electrophoresis ddNTP : 2’,3’-dideoxynucleotide No! 3’ hydroxyl residue Run four separate reactions each with different ddNTPs Run on a gel in four separate lanes Read the gel from the bottom up Sanger Sequencing (1st generation sequencing) So What’s Wrong With It? The dideoxy (Sanger) method is good only for 500-750 bp reactions Expensive Takes a while The human genome is about 3 billion bp Human Genome Project Began in 1990 Why? Human evolution Nature versus nurture Causes of disease Shotgun Sequencing Used to sequence whole genomes Steps: DNA is broken up randomly into smaller fragments Dideoxy method produces reads Look for overlap of reads Strand Sequence First Shotgun Sequence AGCATGCTGCAGTCATGCT--------------------------TAGGCTA Second Shotgun Sequence AGCATG--------------------------CTGCAGTCATGCTTAGGCTA Reconstruction AGCATGCTGCAGTCATGCTTAGGCTA Next Generation Sequencing: Why Now? NGS is a general term refering to all post-Sanger sequencing technologies that enable massive sequencing at low cost. NGS may be further divided into polony-sequencing based technologies which require the amplification of DNA prior to sequencing, and single molecule sequencing which do not. Motivation for new technologies drives its roots not only from potentially commercial usage such as in personalised medicine, but also from government supported projects such as the HGP or the 1000 genomes projects aiming to sequence the genomes of 1000 individuals around the world with price tag for genome sequencing single genomes set to 50,000$. Throughput, scalability, speed, and resolution Short reads applications: Other than de-novo sequencing. Potential applications include re-sequencing, and also gene expression analy