The Gatewayreg; Cloning System课件.pptVIP

The Gateway? Cloning System MultiSite Gateway? - Extending the applications Sample Applications Optimized multigene delivery without co-transfection Expression of enzymatic pathways Expression of multi-subunit protein complexes Gene knock-down and rescue (controllable RNAi and heterologous gene expression from the same construct) Variable gene expression levels using different expression elements Combinatorial tagging 2-fragment MultiSite Gateway? Pro 3-fragment MultiSite Gateway? Pro 4-fragment MultiSite Gateway? Pro MultiSite Gateway? Three-Fragment Vector Construction Kit Typical Results In silico cloning using Vector NTI AdvanceTM 10.3 Shortcomings when co-transfecting two plasmids Example: Expression of Multiple Genes in Human Cells Summary for MultiSite Gateway? Technology *Invitrogen Proprietary Confidential Cloning multiple fragments into a single vector Contents How to clone up to 4 DNA fragments simultaneously into one destination vector. Examples of expression of multiple genes in HeLa cells. Example of testing the effects of promoters and regulatory elements on protein expression. Your Application Gene1 Gene2 Gene3 Gene4 Your Application Gene Protein Localization Gene Gene Protein Purification Gene RNAi Gene Cell-Free Gene Protein interaction Gene Gene Entry Clone PCR Gene synthesis ORF collection Library Your Source ? CTGCTTTTTTGTACAAACTTG attB1 ? CAGCTTTCTTGTACAAAGTTG attB2 ? CAACTTTATTATACAAAGTTG attB3 ? CAACTTTTCTATACAAAGTTG attB4 ? CAACTTTTGTATACAAAGTTG attB5 Standard Gateway? MultiSite Gateway? More att sequences needed X X X X X X attB2 attB5 attP2 attP5 attR2 attR1 attB5r attB1 attP5r attP1 attL5 attL1 attB2 attB5 attB1 attL2 attR5 PCR Fragments pDONRs Entry Clones Destination Vectors Expression clones BP reactions LR reaction X X attB2 attB1 attB3 attB4 attL4 attL1 attL2 attL3 attR2 attR1 Entry clones Destination vector Expression clone attR3 attR4 CmR ccdB attB4 attB1 attP4 attP1 X X attB3r attB4r attP3r attP4r X X attB2