GeneticsandRecombinantDNA.ppt

cDNA library construction - step 2 cDNA library construction - step 3 Alternate cloning tool - PCR Polymerase chain reaction amplification of small DNA quantities clone from genomic or cDNA source thermostable polymerase - heat to separate DNA strands PCR step 1: Denaturation PCR step 2 - Annealing PCR step 3 - Extension After one round of PCR After 2 rounds of PCR After 3 round of PCR Required Components of PCR DNA template DNA thermocycler (or water baths) pool of free dNTPs Taq (or other heat-stable) DNA polymerase Primers - annealed at appropriate temperatures Conditions for PCR Denature: 94?C to 100?C , 1 minute For anneal temperature, 2?C for every A and T, 4 ?C for every C and G. 1minute - 2 minutes - GO 3-5 DEGREES BELOW THAT TEMPERATURE Extension: 72 ?C for 2 minutes Do this 30 cycles machine programmable Problem What is the annealing temperature for the following primer (a 21 mer)?: AAGCTTGTCCAGAATTTCGGC Solution 11 A/T X 2 = 22 10 C/G X 4 = 40 22 + 40 + 62 Go a few degrees below that number, so you would anneal at about 58?C Applications of recombinant DNA Diagnosis of genes by RFLP (restriction fragment length polymorphisms) Example sickle cell anemia RFLPrestriction fragment length polymorphism converts a GAG codon (for Glu) to a GTG codon for Val abolishes a sequence (CTGAGG, which spans codons 5, 6, and 7) recognized and cut by one of the restriction enzymes. Other diseases identified by RFLP Cystic fibrosis Huntington’s disease Loss (or gain) of restriction enzyme sites when amino acid change in middle of codon, and thus, protein How do you know sequence of DNA? Sanger sequencing - named after Fred Sanger utilizes 2,3-dideoxynucleotide triphospates (ddNTPs), molecules that differ from deoxynucleotides by the having a hydrogen atom attached to the 3 carbon rather than an OH group. (see upcoming figure) Sanger (dideoxysequencing) sequencing Need polymerase dNTPs ddNTPs primer DNA template Sanger method Product of sequencing Cell