BiotechnologyHomework5Fall2011DueonOct.19th.docVIP

Biotechnology Homework 5 Fall 2011 Due on Oct. 19th 1. Imagine that you have a segment of about 2kb of genomic DNA from a mammal cloned in a plasmid vector. You obtained the complete sequence of this 2kb segment. (i) How would you most likely have obtained the 2kb DNA sequence (experimentally, in outline)? [1] You also used this 2kb piece of DNA to make an RNA probe for a Northern blot of lymphocyte mRNA from the mammal in question. (ii) How would you make the RNA probe (in outline)? [1] You see a band of 4.8kb. Consequently, you believe it is likely that portions of this cloned DNA are transcribed, processed to mRNA and translated into a protein. Furthermore, because your probe was single-stranded you can deduce the orientation of the mRNA relative to your genomic DNA sequence. The sequences of two small sections within the 2kb genomic sequence, separated by a gap [denoted by “ …. “] of about 1kb are written out below showing the DNA strand that is in the same orientation as the inferred mRNA (written 5’ to 3’ as always and continuous from one line to the next). ……….GTAATCCATCCCACCTCAGGCGTACCACATGTCCTACATGGCTAAAATGCTGAA GGAGCAGAGTAATCCCGTGCAGTTAGTGCGACAGTACTTTAAGAAACTCGAGAGGGTA AGTCCAAAACCAAAATTATAAATAATA…..[1kb].… ……..AAGCAAACCCTAAATACTAACGAT ATTGTTATTCATATCTTTGGCAGGAACACGTCACCCTGGATGCCAGGAGACAGGTAATC AGCCCCGATGACTGCGAAGATCTTAGCCCGATGACACAAACAGCTGCTCCACCGGTTCG TAGGCTAGGCGGAATC………… I am going to ask you to perform (yourself, without using a computer) some simple versions of tasks that would normally be part of more sophisticated, automated searching programs used by computers to examine much longer stretches of sequence. An open reading frame (ORF) is a stretch of sequence with no stop codons in a given reading frame. It does not need to include a methionine codon (contrary to some definitions you can find, even in textbooks and websites). Any stretch of DNA sequence has three potential reading fram