Antitumor Effects of Conditional Replication Adenovirus in Combination with Cisplatin on Lung Cancer.docVIP

Engineering, 2012, 5, 163-164 doi:10.4236/eng.2012.410B042 Published Online October 2012 (http://www.SciRP.org/journal/eng) Antitumor Effects of Conditional Replication Adenovirus in Combination with Cisplatin on Lung Cancer Yanan Liu, Yinghui Huang China-Japan Union Hospital ofJilin university, Jilin, China Email: dl0009@, yhuang@ Received 2012 ABSTRACT Object: To explore the therapeutic effects and therapeutic mechanisms of Conditional Replication Adenovirus(CRAd) in combination with cisplatin on lung cancer cells. Methods: Using MTS / PMS assay, in vitro cell inhibition assay was performed to detect the cell viability of two lung cancer cell lines, NCI-H292 and NCI-H661. PCR was employed to detect the Coxsackie receptor(CAR) expres- sion of cancer cells. The in vivo anti-tumor effect of CRAd and cisplatin was evaluated using a subcutaneous mouse model. Results: The CRAd with cisplatin is superior to the use of cisplatin or CRAd viruse alone on the suppression of lung cancer cell growth. The mechanism of inhibition is associated with the increased CAR expression. Conclusion: The application of CRAd in combination with cisplatin could play a better therapeutic effect on lung cancer cell growth inhibition. Keywords: Lung Cancer; Adenovirus; Cisplatin 1. Introduction After treated with cisplatin, NCI-H292 and NCI-H661 cells were collected , total RNA was extracted , each sample was converted to complementary cDNA , primer sequence is below: GAPDH: S: 5GATTGTTGCCATCAACGACC3 AS: 5 Lung cancer is the second highest incidence of malignant tu- mors and the most common cause of cancer mortality [1]. Cis- platin (also known as DDP) is a chemotherpeutic drug often used to treat lung cancer, but serious side effects and drug re- sistance have severe impacts on clinical application [2,3]. CRAd (conditionally replication adenovirus) is able to specifi- cally replicate and proliferate in tumor cells. Whe