JacksonPGIAtlantaOct培训讲义.pptVIP

Genome Sequencing in the Legumes Phylogeny Major sequencing efforts Minor sequencing efforts Papilionoideae in GenBank Types of sequencing Physical map -- Sequence map Traditional--human Arabidopsis Sequence map -- Physical map Drosophila Incomplete sequence map With or without physical information Physical to Sequence (rice, Arabidopsis, human) Map-based Genome Sequencing Shotgun sequencing Shotgun Genome Sequencing Outcomes Map-based approach Highly ordered, clone-based, genetically integrated, contiguous sequence (gold standard) Slower, costly Shotgun approach Initially disordered, though can be genetically integrated May or may not have underlying physical map May have assembly problems Fast and less expensive Prerequisites Understand genome structure Neopolyploidy? Repeat content? Repeat distribution? Comparisons to related genomes. How valuable will they be? Leveraging Genomes Understand and introgress diversity Marker development for selection and gene cloning Basic questions: evolution, genome structure How to deal with incompletely sequenced genomes Genetic and physical maps/information are imperative Leverage related genomes to aid in assembly Target finishing to regions of interest Genic/QTLs/anchored scaffolds… Low coverage sequencing of MTP or entire BAC library * Le et al. 2007 ~14 MY ~45 MY Zhu et al. 2005 Genome ..actggtcgtaatgtagttgccctcagfgttagtaattttattgtagtatgatgt.. ? 150 kb fragments BAC library fingerprint Integrate genetic physical map Chromosome Genetic map Physical map actggagtggatgaactgactaaactgtaactgtacgatcgtttagctacggcggcgatcgatcgggtcagcacgtagctagctgacgtgggctagctaattatacgatcggagatcgatcgtaatcggatcgatcgcgcggcatctacgatcgatcgtagctagtc Minimum Tiling Path Soybean chromosomes contig scaffold Lots of contigs/scaffolds Not anchored to genetic map Chromosome Genetic map Physical map shotgun sequence Genus Oryza A - O. rufipogon B - O. nivara C - O. glaberrima Doyle an