High-throughput genotyping文档.pptVIP

* * * * * * * * * * * * * * * * Use 2 types of markers. Proficient at scoring microsatellites using fluorescently labeled products on capillary electrophoresis instruments. Single nucleotide polymorphism (SNP) PCR Primer extension reaction designed products different mass Automatically scored * * Requires higher purity of sample for analysis--extensive processing * Finnish Genome Center Finnish Genome Center * * High-throughput genotyping Finnish Genome Center What is genotyping? the analysis of DNA-sequence variation genotype = the genetic constitution of an individual * Finnish Genome Center Alleles alternative form of a gene or DNA sequence at a specific chromosomal location (locus) at each locus an individual possesses two alleles, one inherited from the father one from the mother → genotype: a sum of these two alleles * Finnish Genome Center Genetic differences: may cause or predispose to diseases determines e.g. individual drug response used as markers to identify predisposing genes for diseases → high-throughput genotyping technologies needed * Finnish Genome Center Microsatellite markers Di-, tri-, tetranucleotide repeats GAACGTACTCACACACACACACATTTGAC TTCGATGATAGATAGATAGATAGATACGT * Finnish Genome Center ...Microsatellite markers also called: STR= Single Tandem Repeat SSR= Simple Sequence Repeat SSLP= Simple Sequence Length Polymorphism the number of repeats varies (→ 30) highly polymorphic distributed evenly throughout the genome easy to detect by PCR * Finnish Genome Center SNP markers single nucleotide variation GTGGACGTGCTT[G/C]TCGATTTACCTAG * Finnish Genome Center The most simple and common type of polymorphism Highly abundant; every 1000 bp along human genome Most SNPs do not affect on cell function some SNPs could predispose people to disease influence the individual’s response to a drug Widely used as genetic markers ...SNP markers * Finnish Genome Center SNP genotyping methods over 100 different approaches Ideal SNP genotyping plat