Site-directedmutagenesis.pptVIP

* * Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences Overview Cloning (of PCR products) Polymerase chain reaction (PCR) Site-directed mutagenesis Cloning of a region of interest into a plasmid Choose the right vector (+/- tag, and if tagged, a C- or N-terminal tag). Blunt end or sticky end cloning. Check that the enzymes chosen in the MCS for the cloning don’t cut in the region of interest. Check that there is enough “space” in-between the two enzymes in the MCS. Sticky ends Blunt ends Plasmid Region of interest MCS Primers Check the reading frame. C-terminal tag: Add a Kozak consensus sequence (ANNATGG) if it is a C-terminal tag, and again remember to clone the gene in frame with the C-terminal tag. Don’t forget to take the STOP codon out. Choose enzymes in the MCS to add to the primer that do not cut in the insert. Primers should be 15-30 nucleotides long and have a GC content of 40-60 %. The forward and reverse primer should have similar melting temperatures (Tm’s). Try to avoid primer dimer and hairpin formation. For sticky end ligation remember to add additional nucleotides to the 5’ side of the restriction site. The restriction site sequences should be followed by ? 15 bases that are homologous to the template DNA. The 3’-end of the primer has to end on an C or a G. Restriction enzymes (NEB) oligo % cleavage sequence 2h 20h BamHI CGGATCCG 10 25 CGGGATCCCG 90 90 CGCGGATCCGCG 90 90 EcoRI GGAATTCC 90 90 CGGAATTCCG 90 90 CCGGAATTCCGG 90 90 HindIII CAAGCTTG 0 0 CCAAGCTTGG 0 0 CCCAAGCTTGGG 10 75 NcoI CCCATGGG 0 0 CATGCCATGGCATG 50 75 NdeI GGGTTTCATATGAAACCC 0 0 GGAATTCCATATGGAATTCC 75 90 The principle of the PCR (Roche) The pu