MUC1 gene expression in peripheral blood of esophageal cancer micrometastasis.doc

 PAGE \* MERGEFORMAT 9 MUC1 gene expression in peripheral blood of esophageal cancer micrometastasis Of: Shih Shun Bin, Yu Li Chao, Hu Jiabo, Zhu Xiao, the Xu Wenrong [Keywords:] esophageal cancer; adhesion protein; micrometastasis; reverse transcription polymerase chain reaction 1 Materials and Methods 1.1 disease cases Without metastasis: Select January 2006 to May 2006 in our hospital and diagnosed as esophageal squamous cell carcinoma by B-, CT or intraoperative exploration of distant metastasis is not found in 53 patients. Metastases: pathological diagnosis during the same period esophageal squamous cell carcinoma, but also by B-, CT or intraoperative exploration clearly found to have distant metastases in 10 cases. benign control group: the same period, 7 cases of esophagitis, cardiac disease lost relaxation in 2 cases, 1 case of esophageal burns. 1.2 specimen collection and processing Without metastasis, all patients in the control group were not collected specimens of the line before any treatment for cancer, collected blood (heparin are required to collect specimens), the first out of 1 ml was discarded, and then specimens from 5 ml. Erythrocyte lysis buffer red blood cell lysis, separation of nucleated cells, frozen in liquid nitrogen after, -80 stored for use. 1.3 method Extracted using Trizol reagent total RNA, RNA made by 1% agarose gel electrophoresis. To 1 g as template, Oligo dT as primer, placed in 70 bath for 5 min, the ice bath 2 min, then add reverse transcriptase , dNTP, etc., incubated at 42 1.5 h synthesis of cDNA, 94 denaturation inactivated reverse transcriptase enzyme and 5 min, the cDNA as a template for PCR amplification. MUC1 gene primer design sequence is as follows [2,3] (outer primers A and B, inner primers C and D, the product was 510 bp, 287 bp) A: 5 ‘ATGCCAGTAGCACTCACCATAG 3’, B: 5 ‘CAGCCAAGGCAATGAGATAGAC 3’; C: 5 ‘CGTCGTGGACATTGATGGTACC 3’, D: 5 ‘GGTACCTCCTCTCACCTCCTCCAA 3’. -actin as internal c