生物化学-核酸2推荐.ppt

Structure of a ddNTP (dideoxynucleotide) O BASE (A, T, G, C) HO O P O P O P C O O O O- O- O- O- OH O O O O BASE (A, T, G, C) O P O P O P C O- O- O- O- OH Structure of a dNTP * 5’ 3’ ||||||||||||||| ddATP DNA dNTPs ddTTP DNA dNTPs ddGTP DNA dNTPs ddCTP DNA dNTPs A T C A T G T C A T C A A G T C T A G C A C T A T A G T A T A G T A C A T A G T A C A G T A T A G T A C A G T A G T T C A T A G T A C A G T A G T T C A G A All possible products of the reaction containing ddATP Each fragment is terminated by a ddA DNA sequence * 5’ 3’ ||||||||||||||| A T C A T G T C A T C A A G T C T A G C A C A T G C TAGTACAGTAGTTCAGATCGTG Longer fragments Shorter fragments Sequence of the strand that was synthesized * * * * This slide compares the structures of deoxy- and dideoxynucleotides. Note that the ddNTP lacks the 3 OH which is essential for adding the next nucleotide during DNA synthesis. Incorporation of a dideoxy results in chain termination at the site of incorporation. Compare the ddNTP in this slide to AZT in the next slide. * DNA synthesis is carried out in four different reaction sets, each specific for a different nucleotide. Each reaction set has one of the four dideoxynucleotides (ddNTPs) and all four of the regular deoxynucleotides (dNTPs). All of the dNTPs have to be included to allow synthesis to proceed through to the end of the sequence. All of the possible fragments from that DNA template are generated in these four different DNA synthesis reactions. Shown in this figure are all six possible fragments that are terminated with ddA. * This slide shows a gel electrophoresis analysis for the DNA fragments obtained in the sequencing reactions. The products of each reaction are electrophoresed in separate lanes (A, T, G, C), with the products of the “A” reaction shown in red. Electrophoresis separates the fragments from the longest at the top to the shortest at the bottom. Each fragment differs from the next longer or shorter fr