Combinatorial Pattern Matching.pptVIP

Combinatorial Pattern Matching Outline Hash Tables Repeat Finding Exact Pattern Matching Keyword Trees Suffix Trees Heuristic Similarity Search Algorithms Approximate String Matching Filtration Comparing a Sequence Against a Database Algorithm behind BLAST Statistics behind BLAST PatternHunter and BLAT Outline- CHANGES Hash Tables – CHANGE- start from an example-modify Heuristic Similarity Search Algorithms _SHOW FILTERED DOT-MATRIX Genomic Repeats Example of repeats: ATGGTCTAGGTCCTAGTGGTC Motivation to find them: Genomic rearrangements are often associated with repeats Trace evolutionary se