Whatarethegenesconservedbetweenyeastandhumans.pptVIP

* * What are the genes conserved between yeast and humans? How are these genes regulated? Why is this information valuable? Issues addressed will include: Phylogenetic Tree Photosynthetic Bacteria Plants Insects N. crassa Baker’s yeast Human Aerobic Respiration C6H12O6 + 6 O2 + 38 ADP +38 Pi 6 CO2 + 44 H2O + 38 ATP Human Yeast same pathway 19 times more efficient Anaerobic Respiration Humans: C6H12O6 + 2 ADP +2 Pi 2 Lactate + 2 H+ + 2 H20 + 2 ATP Yeast: C6H12O6 + 2 ADP +2 Pi 2 Ethanol + 2 CO2 + 2 H20 + 2 ATP Human/Yeast homologues involved in respiratory processes Eif5-a TIF51A-B SOD SOD1 ANT2 AAC3 TUPLE1 TUP1 COX15 COX15 HUMAN YEAST FUNCTION Aerobic and anaerobic in yeast; promotes formation of first peptide bond in translation Superoxide dismutase; provides protection from oxygen toxicity ADP/ATP transporter in mitochondria involved in glucose repression cytochrome c oxidase Due to complex intron exon structure, nucleotide homology appears lower than protein. COX proteins are homologous in human and yeast Protein sequence homology shows conservation of the proteins involved in aerobic and anaerobic processes Most of the genes involved in respiration are regulated at a transcriptional level These regulators include: YEAST HUMAN ROX1-represses most known anaerobic genes consensus binding site:YYATTGTTCTC represses:HEM13, TIF51-b, ERG11, ANB1, COX5, AAC3 O2 and Heme- induces ROX1; represses: DAN1 HAP1-induces many anaerobic genes including: ERG11, TIF51-a, CYC7, HEM13, HAP2/3/4-induces: COX genes HIF1-hypoxia inducing factors activates many of the enymes in anaerobic glycolysis targets include: ALD-A, PGK1, enolase1, LDH-A, PFKL other genes that show HIF1 binding include: TH, VEGF, GLUT1 WHERE ARE THE OTHER REGULATORS? Regulatory consensus sites Repressor sites: Rox1: HEM13, TIF51B YYYATTGTTCTC ERG11 AAACGAUYAAACGAA AAACGAAACGAAACGAAACTAA ANB1 AAGGAACGAACAA COX5B AACGAACGA Consensus Activat