microRNA与血管疾病英文课件.pptVIP

IGF-1, microRNA and Vascular Disease  Insulin-Like Growth Factor 1(IGF-1) IGF family (insulin, IGF-1 and IGF-2) Single-chain polypeptide (70 amino acid) Circulating IGF-1 is generated by liver under the control of growth hormone, and represents endocrine form IGF-1 is synthesized by almost every tissue, and represents autocrine and paracrine forms IGF-1 exerts all of its known physiological effects upon binding to IGF-1R, and the action of IGF-1 is modulated by IGFBPs The Structure of IGF-1R The Mechanisms of Atherosclerosis oxLDL Decreases Mitochondrial Membrane Potential (??)  miR-1, Cx43 and Ik1 microRNA and Heart Function miR-221 and miR-222 Antagomirs attenuate the effects of IGF-1 infusion on EPC and c-kit Antagomirs, single-stranded RNA oligonucleotides complementary to specific miRNA with chemical modification for stability and cholesterol conjugation for better delivery – are well suited to block miRNA functions in small animals. It is essential to example specific miRNAs that target the perfect mixture of mRNAs encoding growth factors and signaling proteins to modulate angiogenesis in vivo. Structure of Antagomir IGF-1, miR-155 and AT1R Methods: mirVana miRNA isolation mirVana qRT-PCR miRNA Detection 5S rRNA as control. Results: IGF-1 increase miR155 expression, and decrease AT1R expression in VSMC. Has-miR-206::IGF-1 Complementary IGF1 (NM_000618) Position 151-158 of IGF1 3’UTR 5’ …GAAAUACACAAGUAAACAUUCCA… 3’ … GGUGUGUGAAGGAAUGUAAGGU… Has-miR-1::IGF-1 Complementary IGF1 (NM_000618) Position 151-158 of IGF1 3’UTR 5’ …GAAAUACACAAGUAAACAUUCCA… 3’ …AUGUAUGAAGAAA-- UGUAAGGU Websites http://microrna.sanger.ac.uk /mirscan Tool for miRNA Functional Analysis Summary IGF-1 is a potent survival factor for vascular cells and stem cells, preventing oxLDL-induced mitochondrial dysfunction, cytochrome C release and apoptosis through a IGF-1R/PI3 – kinase/Akt signaling pathway. IGF-1 increase CXCR4 and migration of MSC. IGF-1 infusion prevents the develo