Real Time RT PCR Data Analysis.pptVIP

Real Time RT PCR Data Analysis Research Plan Today’s Laboratory Objectives 1. To learn how to interpret real time PCR data. Melt Curve Analysis Analysis of Cycle Thresholds Calculating Relative Fold Change using the 2ΔCt method 2. To interpret real time RT PCR data and draw meaningful conclusions: ie, determine the relative quantitation of RBCS3 or Cab-1b transcript levels in light- vs. dark-grown tomato plants Plate Set Up RubisCO Primer Sets Start Length Tm %G+C Seq Primer Set A Left Primer 276 20 60.69 45 AAATGGATGGGTTCCTTGCT Right Primer 422 20 59.58 5