Recombinant DNA Biotechnology.pptVIP

Recombinant DNA  Biotechnology Recombinant DNA recombinant DNA molecules contain DNA from different organisms any two DNAs are joined by DNA ligase 5’GGATCATGTA-OH P-CCCGATTTCAAT 3’CCTAGTACAT-P HO-GGGCTAAAGTTA 5’GGATCATGTACCCGATTTCAAT 3’CCTAGTACATGGGCTAAAGTTA restriction enzymes degrade invading viral DNAFigure 16.1 Cleaving and Rejoining DNA RE produce many different DNA fragments restriction enzymes recognize specific DNA sequences (recognition sites) staggered cuts produce “sticky ends”Figure 16.4 Cutting and Rejoining DNA restriction enzymes (RE) produce specific DNA fragme