真菌检测鉴定通用引物-Fungal Primers.doc

ITS1: 5’-CCGTAGGTGAACCTGCGG ITS4: 5’-TCCTCCGCTTATTGATATGC-3’ Tm 55 NS17: CATGTCTAAGTTTAAGCAA NS3: GCAAGTCTGGTGCCAGCAGCC NS4: CTTCCGTCAATTCCTTTAAG NS22: AATTAAGCAGACAAATCACT NS24: AAACCTTgTTACgACTTTTA LR0R: 5’-GTACCCGCTGAACTTAAGC-3’ LR3: 5’-CCGTGT LR3R: 5’-GTCTTGAAACACGGACC (complementary to RLR3R: GGTCCGTGTTTCAAGAC LR5: 5’-TTAAAAAGCTCGTAGTTGAAC-3’ LR7: 5’- LR12: 5’- Lr0R/LR5: Tm 50-52℃ NL1: 5’-GCATATCAATAAGCGGAGGAAAAG NL1: 5′-TGCGTTGATTACGTCCCTGC (also called V9: TGCGTTGATTACGTCCCTGC) NL1: 5’-TGCTGGAGCCATGGATC-3 NL2: 5’-CTCTCTTTTCAAAGTTCTTTTCATCT NL2: 5’-AACGGCTTCGACAACAGC-3 NL2: 5’-CTTGTTCGCTATCGGTCTC (also NL2A: 5′-CTTGTTCGCTATCGGTCTC) NL2: 5’-TACTTGTTCGCTATCGGTCT-3 NL3: 5’-GAGACCGATAGCGAACAAG (also NL3A: 5’-GAGACCGATAGCGAACAAG) NL3: 5’-AGACCGATAGCGAACAAGTA NL3: 5’-GCTGTTGTCGAAGCCGTT-3 NL4: 5’-GGTCCGTGTTTCAAGACGG （similar to RLR3R：5′-GGTCCGTGTTTCAAGAC) NL4: 5’-TAGATACATGGCGCAGTC-3 Conserved primer sequences for PCR amplification and sequencing from nuclear ribosomal RNA ( HYPERLINK /fungi/mycolab/primers.htm /fungi/mycolab/primers.htm) Vilgalys lab, Duke Over the years, our lab has compiled a useful list of conserved primer sequences useful for amplification and sequencing of nuclear rDNA from most major groups of fungi (primarily Eumycota), as well as other eukaryotes. All of these primers were identified and tested by our own lab based on consensus between the published large and small subunit RNA sequences from fungi, plants and other eukaryotes; sources of other useful primer sequences from published literature are also indicated. Together, these primers span most of the nuclear rDNA coding region (see figures), permitting amplification of any desired region. Standard symbols are used for the four primary nucleotides; variable positions are indicated as follows: P=A,G / Q=C,T / R=A,T / V=A,C / W=G,T. Primers ending with R represent the coding strand (same as RNA). All other primers are complementary to the coding strand. This information is provided fre